ی تک نوکلئوتیدی متمایز هستند، ARMS همچنین PCR آلل-خاص یا تکثیر PCR آلل های خاص (PASA) نامیده شده است. بنابراین، یک پرایمر ARMS می تواند برای تکثیر یک آلل خاص از یک سیستم چند آللی طراحی شود؛ در حالی که برای تکثیر آلل دیگری که ممکن است به کوچکی یک باز از حالت پیشین doffer (گردش) داشته باشد مقاوم باقی بماند. مزیت اصلی ARMS این است که مرحله تکثیر و مراحل تشخیصی با هم ترکیب شده اند، که در آن حضور یک محصول تکثیر شده، حضور یک آلل خاص را نشان می دهد و بالعکس. برای تشخیص معمولی، این ویژگی ARMS بدین معنی است که یک روش کارآمدتر در صرفه جویی زمان است. با این حال، ترکیب مراحل تشخیصی و تکثیر به یک سیستم، ممکن است به همان قدرتمندی بعضی از روش ها که در آن این دو مرحله مهم از هم جدا شده، نباشد، به عنوان مثال، PCR که توسط آنالیز آنزیم محدودکننده دنبال شده است. ARMS نیز به کمک آنزیم Taq انجام می شود؛ DNA پلی مرازی که به طور معمول در PCR مورد استفاده قرار می گیرد و فاقد فعالیت اگزونوکلئازی ‘۳ به ‘۵ است؛ بنابراین عدم تطابق بین انتهای ‘۳ پرایمرهای PCR و الگو منجر به کاهش بازده تکثیر خواهد شد (شکل ۲-۴).
ARMS-PCR تترا پرایمر، دو جفت پرایمر برای تکثیر دو آلل در یک واکنش PCR را به کار می گیرد. پرایمرها به طوری طراحی شده که زوج های دو پرایمری در یک محل پلی مورفیسم تک نوکلئوتیدی با هم همپوشانی دارند اما هریک با تنها یکی از پلی مورفیسم های تک نوکلئوتیدی کاملاً جور می باشد. به عنوان یک نتیجه، اگر یک آلل معین در واکنش زنجیره ای پلی مراز موجود باشد، جفت پرایمر خاص برای آن آلل محصول تولید می کنند اما برای آلل متناوب با پلی مورفیسم تک نوکلئوتیدی متفاوت محصول تولید نمی کنند. جفت های دو پرایمری نیز به طوری طراحی شده که محصولات واکنش زنجیره ای پلی مراز آنها دارای طول های به طور قابل توجهی متفاوت هستند که اجازه می دهد باند ها بر روی ژل الکتروفورز به راحتی تشخیص داده شود.

۲-۴-طرح شماتیکی از ARMS

در روش ARMS دو واکنش PCR با استفاده از یک DNA الگو انجام می شود، که در هر واکنش پرایمر مشترک به همراه یکی از دو پرایمر اختصاصی آلل مورد استفاده قرار می گیرد. در یک واکنش پرایمری استفاده می شود که تکثیر را از روی یک آلل انجام می دهد و در واکنش دوم پرایمر دوم استفاده می شود که آلل حالت دوم را تکثیر می کند. حالت اختصاصی این پرایمر ها برای هر یک از آلل ها ناشی از نوکلئوتید ʹ۳ آنها است که با هم متفاوت بوده و در واقع مربوط به محل متفاوت بین دو آلل می باشد.

جدول۲-۱: پرایمرهای مورد استفاده جهت انجام ARMS PCR

Sequence (5′ to 3’)

Primers

پلی مورفیسم ژن
AAGACGCCGCTTCTGTGCACT
CACAGGGACCCAGGATAACTTGCT
GGAGGCAGACCAGGCACTAGAAA
ACCATCTCTCTGGCTTCAGGCTTC
F1 (T allele)
R1(A allele) F0
R0

Vaspin rs2236242

جدول۲-۲: میزان مواد مورد نیاز برای آزمایش PCR جهت تکثیر ژن واسپین
غلظت نهایی در حجم µl 25
حجم مورد نیاز (µl)
ماده

۱۳
D.W
X1
۵/۲
۱۰X PCR buffer
pmol/µl 10
۱
P.F0
pmol/µl 20
۲
P.F1G
pmol/µl 10
۱
P.R0
pmol/µl 20
۲
P.R1T
mM5/1
۷۵/۰
Mgcl2
mM200
۵/۰
dNTP
U5/1
۳/۰
Taq

۲
DNA

۲۵
حجم نهایی

جدول۲-۳- برنامه (PCR) جهت تکثیر ژن واسپین
تعداد سیکل
زمان
دما (درجه سلسیوس)
مرحله
۱
۵ دقیقه
۹۵
Initial denaturation

۳۰

۳۰ ثانیه
۹۵
Denaturation

۶۰
Annealing

۷۲
Extension
۱
۱۰ دقیقه
۷۲
Final extension

بعد از PCR محصول آن الکتروفورز شد و روی ژل آگارز ۲ درصد انتقال یافت و ژنوتیپ ها تعیین گردید.
۲-۱۰- آنالیز آماری داده ها:
ارتباط بین ریسک فاکتورهای مختلف و استعداد ابتلا به سندروم تخمدان پلی کیستیک با استفاده از آنالیز آماری X2 ، رگرسیون لوجستیک و محاسبه OR با فاصله اطمینان ۹۵ درصد بررسی شد. همچنین مقایسه میانگین متغییر ها با استفاده از t-test به وسیله نرم افزار SPSS 18.0، مورد بررسی قرار گرفت.

فصل سوم
نتایج

۳-۱-مشخصات کلی جمعیت مورد مطالعه:
در این مطالعه مورد-شاهدی، پلی مورفیسم ژنتیکی ژن واسپین در ۳۰۰ زن (۱۵۰ زن بیمار مبتلا به سندرم تخمدان پلی کیستیک و ۱۵۰ زن سالم از جمعیت عمومی به عنوان گروه کنترل) با دامنه سنی ۶۴-۱۶ سال و میانگین سنی ۴۶/ ۵ ± ۳۹/۲۹ مورد بررسی قرار گرفت. مشخصات جمعیت مورد مطالعه در جدول ۳-۱ نشان داده شده است.

جدول۳-۱- مشخصات کلی جمعیت مورد مطالعه
مشخصات
سالم
بیمار
تعداد کل
۱۵۰
۱۵۰
دامنه سنی
۴۶-۱۹
۴۵-۱۶
میانگین سنی
۵۸/۵ ±۷۲/۳۰
۵ ±۰۶/۲۸

همانطور که در جدول۲-۳ نشان داده شده است، میانگین وزن بیماران (۸/۱۳ ± ۳/۶۹) نسبت به گروه کنترل (۶/۱۱±۹/۶۴) بیشتر است که این اختلاف از لحاظ آماری معنی دار می باشد (۹/۲=t، ۰۰۴/۰=P). همچنین میانگین BMI بیماران (۲/۵±۷/۲۶) در مقایسه با گروه کنترل (۹/۴±۸۷/۲۴) بیشتر است که این اختلاف نیز از لحاظ آماری معنی دار می باشد (۰۲/۳=t، ۰۰۳/۰=P). با در نظر گرفتن سطح معنی داری ۰۵/۰P مشخص شد که ارتباط معنی داری بین وزن و ابتلا به PCOS وجود دارد یعنی افراد با وزن بیشتر در خطر بیشتری برای بیماری می باشند.به علاوه ارتباط معنی داری بین BMI (شاخص توده بدن) و PCOS وجود دارد به عبارت دیگر خطر ابتلا به PCOS در افراد چاق و دارای اضافه وزن بیشتر از افراد دارای BMI معمول است
جدول ۳-۲- مقایسه میانگین متغیرهای تن سنجی در دو گروه سالم و بیمار
متغیر
سالم
بیمار
t

P
قد
۱۸/۷±۶۱/۱
۱۴/۷±۶۱/۱
۱/۰
۹/۰
وزن
۶/۱۱±۹/۶۴
۸/۱۳±۳/۶۹
۹/۲
۰۰۴/۰
BMI*
۹/۴±۸۷/۲۴
۲/۵±۷/۲۶
۰۲/۳
۰۰۳/۰
*BMI : Body Mass index
.
۳-۲-بررسی فراوانی آللی در جمعیت مورد مطالعه:
فراوانی آلل های مربوط به پلی مورفیسم rs2236242 ژن واسپین در جمعیت مورد مطالعه محاسبه شد. فراوانی آلل T در افراد سالم ۶۸/۰ و فراوانی آلل A در این گروه ۳۲/۰ می باشد با در دست داشتن فراوانی آللی فراوانی های مورد انتظار هر ژنوتیپ به دست آمد و در پایان، با انجام آزمون مربع کای (X2- test)، آنها را با فراوانی های مشاهده شده مقایسه و معنی دار بودن یا نبودن انحراف مشاهده شده از حالت تعادل هاردی-واینبرگ تعیین گردید. گروه کنترل برای توزیع پلی مورفیسم rs2236242 T/A در ژن واسپین در تعادل هاردی-واینبرگ می باشد ( ۰۵/۰ p و ۱=df و ۵۵/۷ = X2). فراوانی آلل T در گروه بیمار ۷۶/۰ و فراوانی آلل A در این گروه ۲۴/۰ می باشد. همچنین توزیع ژنوتیپ های این پلی مورفیسم در گروه بیمار نیز در تعادل هاردی-واینبرگ (۰۵/۰ p و ۱=df و ۰۳/۳ = X2) می باشد (جدول۳-۳).
جدول ۳-۳- فراوانی آللی در جمعیت مورد مطالعه

فراوانی آللT
فراوانی آلل A
افراد سالم
۶۸/۰
۳۲/۰
گروه بیمار
۷۶/۰
۲۴/۰

۳-۳-بررسی ارتباط بین چاقی و ابتلا به PCOS
به منظور بررسی ارتباط بین چاقی و PCOS، افراد دارای BMI کمتر از ۲۵ به عنوان افراد نرمال (کنترل)، افراد دارای ۲۵≤BMI <30 به عنوان افراد دارای اضافه وزن و 30≤ BMI به عنوان افراد چاق در نظر گرفته شد. ریسک ابتلا به بیماری در این سه گروه مقایسه شد. آنالیز آماری نتایج نشان داد که افراد چاق نسبت به افراد دارای BMI نرمال، حدود 2 برابر در خطر بیشتری برای ابتلا به PCOS می باشند(جدول3-4)(03/0=P و 8/3-99/0 :CI 95% و 96/1=OR). جدول3-4-بررسی ارتباط بین چاقی و ابتلا به PCOS وضعیت سالم(%) بیمار(%) CI ) 95 %)OR P نرمال (9/55)76 (2/42)57 1 - اضافه وزن (1/30)41 (37)50 (8/2-95/0)6/1 07/0 چاق (14)19 (7/20)28 (9/3-99/0)96/1 013/0 025/0=P ، 5 :X2 For linear trend 3-4-بررسی پلی مورفیسم rs2236242 در ژن واسپین : جهت تعیین ژنوتیپ های مورد نظر در ناحیه rs2236242 ژن واسپین از تکنیک Tetra-primer ARMS PCR استفاده شد، بدین صورت که پس از استخراج DNA از لنفوسیت های خون محیطی، به کمک پرایمرهای اختصاصی این ناحیه، ARMS PCR انجام شد. پس از الکتروفورز نمونه ها بر روی ژل آگارز دو درصد، ژنوتیپ های TT، TA و AA تعیین شد(شکل3-1). Lane M: DNA ladder (100bp) Lane 1: TT genotype (174bp, 174bp) Lane 2: TA genotype (174bp, 248bp) Lane 3: AA genotype (248bp, 248bp) Lane 4: Negative control شکل3-1- محصول ARMS PCR حاصل از تکثیر ژن واسپین 3-5-بررسی توزیع ژنوتیپ های واسپین در سه گروه طبقه بندی شده براساس BMI جهت بررسی ارتباط بین ژنوتیپ های واسپین و شاخص BMI، افراد بر حسب این شاخص به سه گروه تقسیم شدند و ژنوتیپ های واسپین در این سه گروه مورد بررسی قرار گرفتند. جدول 3-5 و نمودار 3-1 توزیع ژنوتیپ های واسپین در سه گروه طبقه بندی شده براساس BMI را نشان می دهد. جدول 3-5-توزیع ژنوتیپ های واسپین در سه گروه طبقه بندی شده براساس BMI AA (%) TA (%) TT (%) ژنوتیپ واسپین وضعیت (3/58)7 (6/58)75 (9/38)51 BMI < 25 کنترل (3/33)4 (1/28)36 (9/38)51 30 >BMI≥۲۵ اضافه وزن
(۳/۸)۱
(۳/۱۳)۱۷
(۱/۲۲)۲۹
BMI ≥ ۳۰ چاق

۳-۱-نمودار توزیع ژنوتیپ های ژن واسپین بر اساس وضعیت BMI
۳-۶-بررسی ارتباط بین چاقی و ژنوتیپ های واسپین
جهت بررسی ارتباط بین چاقی و ژنوتیپ های ژن واسپین، افراد دارای ۲۵ BMI به عنوان افراد کنترل در نظر گرفته شدند و افراد چاق و دارای اضافه وزن با گروه کنترل مقایسه شدند. فراوانی ژنوتیپ ها در هر سه گروه نرمال، اضافه وزن و چاق در جدول ۳-۵ نشان داده شده است و ارتباط بین ژنوتیپ ها، چاقی و اضافه وزن در جدول ۳-۶ مشخص شده است. نتایج نشان می دهد که اگر آلل A به عنوان غالب در نظر گرفته شود (ژنوتیپ های AA+TA)، این آلل استعداد چاقی و اضافه وزن را در افراد افزایش می دهد. جدول۳-۶- بررسی ارتباط بین چاقی و ژنوتیپ های واسپین
P
OR(%95 CI)
ژنوتیپ
وضعیت

۱
TT

۲۵≤BMI۳۰
۰۱/۰
(۸۴/۰-۲۸/۰)۴۸/۰
TA

۲۹/۰
(۰۷/۲-۱۶/۰)۵۷/۰
AA

۰۰۹/۰
(۸۴/۰-۲۸/۰)۴۹/۰
TA+AA

۱
TT

۳۰≤BMI

۱/۰
(۸/۰-۲)۴۰/۰
TA

۲/۰
(۱/۲-۰۳/۰)۲۵/۰
AA

۰۰۶/۰
(۷۶/۰-۱۹/۰)۳۹/۰
TA + AA

۳-۷-بررسی ارتباط بین ژنوتیپ های واسپین و خطر ابتلا به PCOS
توزیع دقیق ژنوتیپ ها و ارتباط آنها با خطر ابتلا به PCOS در جدول ۳-۷ نشان داده شده است. به منظور ارزیابی این ارتباط ژنوتیپ های مربوط به SNP مورد مطالعه در سه حالت هم بارز، غالب و مغلوب مورد بررسی قرار گرفتند. نتایج حاصل از آنالیز، نشان داد که ژنوتیپ TA در حالت هم بارز خطر ابتلا به PCOS را کاهش داده و اثر حفاظتی بر بیماری دارد(۰۳/۰=P، ۹۵/۰-۳۷/۰=CI، ۵۹/۰=OR).
ژنوتیپ های مربوط به پلی مورفیسم rs2236242 T/A در ژن واسپین در حالت های غالب و مغلوب نیز مورد بررسی قرار گرفت و نتایج نشان داد که آلل A در این پلی مورفیسم به صورت غالب اثر حفاظتی خود را در مصون نگه داشتن از بیماری نشان می دهد(۰۲/۰=P، ۹۲/۰-۳۷/۰=CI%95، ۵۷/۰=OR).
فراوانی آللی نیز در جمعیت سالم و بیمار مورد بررسی قرار گرفت. نتایج نشان داد که حضور آلل A اثر حفاظتی بر ابتلا به PCOS دارد یعنی افراد حامل آلل A نسبت به افراد حامل آلل T در خطر کمتری برای ابتلا به PCOS می باشند (۰۳/۰=P، ۹۶/۰-۴۶/۰=۹۵%CI، ۶۷/۰=OR) (جدول ۳-۷).

جدول ۳-۷-بررسی ارتباط بین ژنوتیپ های واسپین و خطر ابتلا به PCOS
P
OR (95% CI)
بیمار(%)
سالم(%)
ژنوتیپ

Vaspin
SNP rs2236242 T/A

۱

(۷/۵۴)۸۲

(۳/۴۱)۶۲
Codominant-
TT
۰۳/۰
(۹۵/۰-۳۷/۰)۵۹/۰
(۴۲)۶۳
(۳/۵۳)۸۰
TA
۲/۰
(۵/۱-۱۴/۰)۴۷/۰
(۳/۳)۵
(۳/۵)۸
AA

۱

(۷/۵۴)۸۲

(۳/۴۱)۶۲
Dominant-
TT
۰۲/۰
(۹۲/۰-۳۷/۰)۵۷/۰
(۳/۴۵)۶۸
(۷/۵۸)۸۸
TA + AA

۱

(۷/۹۶)۱۴۵

(۷/۹۴)۱۴۲
Recessive
TT +TA

۴/۰
(۹/۱-۱۹/۰)۶۱/۰
(۳/۳)۵
(۳/۵)۸
AA

۱

(۷۶)۲۲۸

(۶۸)۲۰۴
Alleles
T
۰۳/۰
(۹۶/۰-۴۶/۰)۶۷/۰
(۲۴)۷۲
(۳۲)۹۶
A

فصل چهارم
بحث و نتیجه گیری

سندرم تخمدان پلی کیستیک یکی از شایع ترین اختلالات غدد درون ریز زنان می باشد. PCOS اختلال پیچیده، ناهمگن با علت نامشخص است، اما شواهد قوی وجود دارد که می تواند، تا حد زیادی، به صورت بیماری ژنتیکی طبقه بندی گردد(۹۹و۱۰۰). سازمان بهداشت جهانی تخمین می زند که بیماری PCOS، ۱۱۶ میلیون زن در سراسر جهان را تحت تأثیر قرار می دهد (۴/۳ درصد از زنان)(۱۰۱). شیوع PCOS بسته به تعریف ارایه شده از آن، ۴ تا ۲۵ درصد

دسته بندی : No category

دیدگاهتان را بنویسید